effects of chemical inhibition of ca12 Search Results


90
Sino Biological human ca12 qpcr primer pairs
Human Ca12 Qpcr Primer Pairs, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/Human+CA12+qPCR+primer+pairs/custom%40hp100073%4033883691
Average 90 stars, based on 1 article reviews
human ca12 qpcr primer pairs - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

89
Bio-Techne corporation carbonic anhydrase xii/ca12 antibody
Carbonic Anhydrase Xii/Ca12 Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/Carbonic+Anhydrase+XII%2FCA12+Antibody/custom%40nbp1-81668%40pmc12559184__41467_2025_65475_MOESM1_ESM
Average 89 stars, based on 1 article reviews
carbonic anhydrase xii/ca12 antibody - by Bioz Stars, 2026-09
89/100 stars
  Buy from Supplier

90
STEMCELL Technologies Inc stemcell_bonuccelli09_63genes genesigdb
Stemcell Bonuccelli09 63genes Genesigdb, supplied by STEMCELL Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/stemcell+bonuccelli09+63genes+genesigdb/pmc04867636__srep26061___s1-23517-23-52
Average 90 stars, based on 1 article reviews
stemcell_bonuccelli09_63genes genesigdb - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Broad Institute Inc msigdb c2
Msigdb C2, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/msigdb+c2/pmc04867636__srep26061___s1-23331-22-2
Average 90 stars, based on 1 article reviews
msigdb c2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Basell Polyolefine GmbH adflex c200
Adflex C200, supplied by Basell Polyolefine GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/adflex+c200+6+230/us08476360-193-20-2
Average 90 stars, based on 1 article reviews
adflex c200 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma shrna specific for targeting ca12
Shrna Specific For Targeting Ca12, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/ca12+sirna/pm39639339-65-7-28
Average 90 stars, based on 1 article reviews
shrna specific for targeting ca12 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co sirna targeting ca12
Primers for real-time PCR.
Sirna Targeting Ca12, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/ca12+overexpression+plasmid/pmc09957630-58-17-25
Average 90 stars, based on 1 article reviews
sirna targeting ca12 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CH Instruments chi-square test
Primers for real-time PCR.
Chi Square Test, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/chi+square+test/10__1186_slash_1748___717x___5___101-65-3-10
Average 90 stars, based on 1 article reviews
chi-square test - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Cantek Metatron Corp ca12 camera
Primers for real-time PCR.
Ca12 Camera, supplied by Cantek Metatron Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/ca12+camera/us08810655-132-10-14
Average 90 stars, based on 1 article reviews
ca12 camera - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Synthego Inc ca12 knockout crrna2 ggcagcccuacuuaccucgg
Primers for real-time PCR.
Ca12 Knockout Crrna2 Ggcagcccuacuuaccucgg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/ca12+forward+genotyping+ggtggagggagcattgccta+knockout+primer/pmc11646563-927-0-5
Average 86 stars, based on 1 article reviews
ca12 knockout crrna2 ggcagcccuacuuaccucgg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Sino Biological human carbonic anhydrase xii / ca12 protein
Primers for real-time PCR.
Human Carbonic Anhydrase Xii / Ca12 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/Human+Carbonic+Anhydrase+XII+%2F+CA12+Protein/custom%4010617-h08h%4034806527
Average 90 stars, based on 1 article reviews
human carbonic anhydrase xii / ca12 protein - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Sino Biological carbonic anhydrase xii / ca12 antibody, rabbit pab, antigen affinity purified
Primers for real-time PCR.
Carbonic Anhydrase Xii / Ca12 Antibody, Rabbit Pab, Antigen Affinity Purified, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/effects+of+chemical+inhibition+of+ca12/Carbonic+Anhydrase+XII+%2F+CA12+Antibody%2C+Rabbit+PAb%2C+Antigen+Affinity+Purified/custom%4010617-rp02%408992267
Average 90 stars, based on 1 article reviews
carbonic anhydrase xii / ca12 antibody, rabbit pab, antigen affinity purified - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Primers for real-time PCR.

Journal: Oxidative Medicine and Cellular Longevity

Article Title: The Role of the miR-548au-3p/CA12 Axis in Tracheal Chondrogenesis in Congenital Pulmonary Airway Malformations

doi: 10.1155/2023/6428579

Figure Lengend Snippet: Primers for real-time PCR.

Article Snippet: The miR-548au-3p mimics, inhibitor and negative control (NC), CA12 overexpression plasmid, and small interfering RNA (siRNA) targeting CA12 and siRNA NC were provided by Guangzhou RiboBio Co., Ltd. and transfected into rat tracheal chondrocytes.

Techniques:

Identification of DEGs involved in the pathogenesis of CPAM. (a) Flowchart of the study design and samples at each stage of analysis. (b) Scatterplot of mRNA expression variation between diseased CPAM and normal tissues. (c) Hierarchical cluster of gene expression profiles from microarray assays. Expression of CA12, LONRF3, MAP2, THBS1, and PPID at mRNA (d) and protein (e) levels in lung tissues from CPAM and adjacent normal tissues. ∗∗∗ p < 0.001, compared with normal.

Journal: Oxidative Medicine and Cellular Longevity

Article Title: The Role of the miR-548au-3p/CA12 Axis in Tracheal Chondrogenesis in Congenital Pulmonary Airway Malformations

doi: 10.1155/2023/6428579

Figure Lengend Snippet: Identification of DEGs involved in the pathogenesis of CPAM. (a) Flowchart of the study design and samples at each stage of analysis. (b) Scatterplot of mRNA expression variation between diseased CPAM and normal tissues. (c) Hierarchical cluster of gene expression profiles from microarray assays. Expression of CA12, LONRF3, MAP2, THBS1, and PPID at mRNA (d) and protein (e) levels in lung tissues from CPAM and adjacent normal tissues. ∗∗∗ p < 0.001, compared with normal.

Article Snippet: The miR-548au-3p mimics, inhibitor and negative control (NC), CA12 overexpression plasmid, and small interfering RNA (siRNA) targeting CA12 and siRNA NC were provided by Guangzhou RiboBio Co., Ltd. and transfected into rat tracheal chondrocytes.

Techniques: Expressing, Gene Expression, Microarray

CA12 as a direct target of miR-548au-3p. (a) Binding sites between miR-548au-3p and the 3′-UTR region of CA12 mRNA. (b) HEK-293 cells were cotransfected with miR-548au-3p mimics or NC and wild-type or mutant CA12 3′-UTR, followed by luciferase reporter assay. CA12 mRNA (c) and protein (d) levels in rat tracheal chondrocytes after transfection with miR-548au-3p mimics or inhibitor. ∗∗ p < 0.01 and ∗∗∗ p < 0.001, compared with NC.

Journal: Oxidative Medicine and Cellular Longevity

Article Title: The Role of the miR-548au-3p/CA12 Axis in Tracheal Chondrogenesis in Congenital Pulmonary Airway Malformations

doi: 10.1155/2023/6428579

Figure Lengend Snippet: CA12 as a direct target of miR-548au-3p. (a) Binding sites between miR-548au-3p and the 3′-UTR region of CA12 mRNA. (b) HEK-293 cells were cotransfected with miR-548au-3p mimics or NC and wild-type or mutant CA12 3′-UTR, followed by luciferase reporter assay. CA12 mRNA (c) and protein (d) levels in rat tracheal chondrocytes after transfection with miR-548au-3p mimics or inhibitor. ∗∗ p < 0.01 and ∗∗∗ p < 0.001, compared with NC.

Article Snippet: The miR-548au-3p mimics, inhibitor and negative control (NC), CA12 overexpression plasmid, and small interfering RNA (siRNA) targeting CA12 and siRNA NC were provided by Guangzhou RiboBio Co., Ltd. and transfected into rat tracheal chondrocytes.

Techniques: Binding Assay, Mutagenesis, Luciferase, Reporter Assay, Transfection

CA12 suppressed rat tracheal chondrocyte proliferation and differentiation. Rat tracheal chondrocytes were transfected with CA12 overexpression plasmid or CA12 siRNA. (a) Transfection efficiency was determined by western blot. (b) Viability of rat tracheal chondrocytes assessed by CCK-8 assay. (c) Cell proliferation ability assessed by EdU staining. Red fluorescence: EdU; blue fluorescence: DAPI (scale bar = 50 μ m). (d) Cell apoptosis levels assessed by TUNEL staining (scale bar = 50 μ m). Red fluorescence: TUNEL; blue fluorescence: DAPI. (e) Cell apoptosis assessed by flow cytometry with Annexin V/propidium iodide staining. (f) Protein expression of E-cadherin and N-cadherin. (g) The effect of miR-548au-3p on differentiation of rat tracheal chondrocytes assessed with Alcian blue staining (scale bar = 100 μ m). (h) Aggrecan, Col2A1, MMP13, and ADAMTS4 protein levels detected by western blot. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001, compared with vector or siRNA NC.

Journal: Oxidative Medicine and Cellular Longevity

Article Title: The Role of the miR-548au-3p/CA12 Axis in Tracheal Chondrogenesis in Congenital Pulmonary Airway Malformations

doi: 10.1155/2023/6428579

Figure Lengend Snippet: CA12 suppressed rat tracheal chondrocyte proliferation and differentiation. Rat tracheal chondrocytes were transfected with CA12 overexpression plasmid or CA12 siRNA. (a) Transfection efficiency was determined by western blot. (b) Viability of rat tracheal chondrocytes assessed by CCK-8 assay. (c) Cell proliferation ability assessed by EdU staining. Red fluorescence: EdU; blue fluorescence: DAPI (scale bar = 50 μ m). (d) Cell apoptosis levels assessed by TUNEL staining (scale bar = 50 μ m). Red fluorescence: TUNEL; blue fluorescence: DAPI. (e) Cell apoptosis assessed by flow cytometry with Annexin V/propidium iodide staining. (f) Protein expression of E-cadherin and N-cadherin. (g) The effect of miR-548au-3p on differentiation of rat tracheal chondrocytes assessed with Alcian blue staining (scale bar = 100 μ m). (h) Aggrecan, Col2A1, MMP13, and ADAMTS4 protein levels detected by western blot. ∗ p < 0.05, ∗∗ p < 0.01, and ∗∗∗ p < 0.001, compared with vector or siRNA NC.

Article Snippet: The miR-548au-3p mimics, inhibitor and negative control (NC), CA12 overexpression plasmid, and small interfering RNA (siRNA) targeting CA12 and siRNA NC were provided by Guangzhou RiboBio Co., Ltd. and transfected into rat tracheal chondrocytes.

Techniques: Transfection, Over Expression, Plasmid Preparation, Western Blot, CCK-8 Assay, Staining, Fluorescence, TUNEL Assay, Flow Cytometry, Expressing

Knockdown of CA12 abolished miR-548au-3p inhibitor mediated effects on rat tracheal chondrocytes. Rat tracheal chondrocytes were cotransfected with CA12 siRNA and miR-548au-3p inhibitor for 48 h. (a) Transfection efficiency was determined by western blot. (b) Viability of rat tracheal chondrocytes assessed by CCK-8 assay. (c) Cell proliferation ability assessed by EdU staining. Red fluorescence: EdU; blue fluorescence: DAPI (scale bar = 50 μ m). (d) Cell apoptosis assessed by TUNEL staining (scale bar = 50 μ m). Red fluorescence: TUNEL; blue fluorescence: DAPI. (e) Cell apoptosis assessed by flow cytometry with Annexin V/propidium iodide staining. (f) E-cadherin and N-cadherin protein levels assessed by western blot. (g) The effect of miR-548au-3p on chondrogenic differentiation of rat tracheal chondrocytes assessed by Alcian blue staining (scale bar = 100 μ m). (h) Aggrecan, Col2A1, MMP13, and ADAMTS4 protein levels assessed by western blot. ∗∗ p < 0.01 and ∗∗∗ p < 0.001, compared with NC or inhibitor siRNA NC.

Journal: Oxidative Medicine and Cellular Longevity

Article Title: The Role of the miR-548au-3p/CA12 Axis in Tracheal Chondrogenesis in Congenital Pulmonary Airway Malformations

doi: 10.1155/2023/6428579

Figure Lengend Snippet: Knockdown of CA12 abolished miR-548au-3p inhibitor mediated effects on rat tracheal chondrocytes. Rat tracheal chondrocytes were cotransfected with CA12 siRNA and miR-548au-3p inhibitor for 48 h. (a) Transfection efficiency was determined by western blot. (b) Viability of rat tracheal chondrocytes assessed by CCK-8 assay. (c) Cell proliferation ability assessed by EdU staining. Red fluorescence: EdU; blue fluorescence: DAPI (scale bar = 50 μ m). (d) Cell apoptosis assessed by TUNEL staining (scale bar = 50 μ m). Red fluorescence: TUNEL; blue fluorescence: DAPI. (e) Cell apoptosis assessed by flow cytometry with Annexin V/propidium iodide staining. (f) E-cadherin and N-cadherin protein levels assessed by western blot. (g) The effect of miR-548au-3p on chondrogenic differentiation of rat tracheal chondrocytes assessed by Alcian blue staining (scale bar = 100 μ m). (h) Aggrecan, Col2A1, MMP13, and ADAMTS4 protein levels assessed by western blot. ∗∗ p < 0.01 and ∗∗∗ p < 0.001, compared with NC or inhibitor siRNA NC.

Article Snippet: The miR-548au-3p mimics, inhibitor and negative control (NC), CA12 overexpression plasmid, and small interfering RNA (siRNA) targeting CA12 and siRNA NC were provided by Guangzhou RiboBio Co., Ltd. and transfected into rat tracheal chondrocytes.

Techniques: Knockdown, Transfection, Western Blot, CCK-8 Assay, Staining, Fluorescence, TUNEL Assay, Flow Cytometry